Ερευνητές αποθήκευσαν όλα τα σονέτα του Shakespeare και αρχεία MP3 σε ακολουθία DNA! Υπόσχονται 2.2PB σε 1 γραμμάριο DNA!

Το περασμένο καλοκαίρι μάθαμε για τα επιτεύγματα ερευνητών των Stanford University και Harvard, με τους πρώτους να μετατρέπουν το DNA ζωντανών οργανισμών σε μονάδες αποθήκευσης ψηφιακών δεδομένων και τους δεύτερους να αποθηκεύουν βιβλίο 53.000 λέξεων, εικόνες και πρόγραμμα JavaScript σε ακολουθίες DNA.

DNA Storage

Τέτοια κατορθώματα δε θα μπορούσαν να περάσουν απαρατήρητα από άλλα ερευνητικά ιδρύματα και τώρα έρχεται η σειρά του EMBL-European Bioinformatics Institute να ανακοινώσει στο επιστημονικό περιοδικό Nature ότι κατάφεραν να αποθηκεύσουν-κωδικοποιήσουν όλα τα σονέτα του Shakespeare (αρχείο .txt), απόσπασμα της ομιλίας “I Have A Dream” του Martin Luther King (αρχείο .MP3), φωτογραφία του EMBL-EBI (αρχείο .jpeg), τη δημοσίευση των Watson-Crick (αρχείο .PDF) και ένα αρχείο που περιγράφει την κωδικοποίηση, σε βάσεις DNA.

Για να επιτευχθεί η κωδικοποίηση έπρεπε να μεταφραστούν τα ψηφιακά δεδομένα από το δυαδικό (binary) σύστημα σε ένα τριαδικό σύστημα, το οποίο εμπνεύστηκαν οι ερευνητές με γνώμονα τον αριθμό των αζωτούχων βάσεων (A, T, G, C) που απαιτούνται για το σχηματισμό ενός DNA κωδικόνιου (π.χ. ATG, TAG).

DNA Storage Method

Μάλιστα, αποφάσισαν να θεωρήσουν τη μία από τις 4 αζωτούχες βάσεις αμελητέα έτσι ώστε να αποφευχθούν τα συχνά λάθη μετάφρασης που προκύπτουν όταν μία από τις βάσεις επαναλαμβάνεται συνεχώς σε μια ακολουθία DNA.

Δηλαδή, σε μια ακολουθία αυτής της μορφής “ATGGACTTACCACCCCCCCCCTAG” αν θεωρήσουμε αμελητέα τη βάση γουανίνη (G), τότε θα μπορούσαμε να γράψουμε το κομμάτι όπου επαναλαμβάνεται η κυτοσίνη (C) ως εξής “CCGCGCGCC”, χωρίς να αλλάζει το νόημα που κρύβει.

Στη συνέχεια, η ακολουθία χωρίζεται σε τριάδες όπως αναφέραμε προηγουμένως, με τη καθεμια από αυτές να έχει συγκεκριμένη “ταυτότητα” και θέση στο τελικό “αρχείο DNA”.

Με αυτόν τον τρόπο, οι ερευνητές ισχυρίζονται ότι μπορούν να αποθηκεύσουν 2.2PB (1PB = 1000TB = 1.000.000GB) σε 1 γραμμάριο DNA! Για να εντυπωσιαστείτε ακόμα περισσότερο, να σημειώσουμε ότι ένας τέτοιος “βιολογικός σκληρός δίσκος” μπορεί να διατηρήσει την πληροφορία για 5-10 χιλιάδες χρόνια αν καταψυχθεί, ωστόσο, οι ερευνητές φιλοδοξούν ότι μέσα στα επόμενα χρόνια θα καταφέρουν να κατασκευάσουν πιο “οικονομικά μοντέλα” με διάρκεια ζωής περίπου 50 χρόνια.

[NewScientistTGDaily]

About Chris Elpidis

Σχόλια, κριτική, κοπλιμέντα, αφορισμοί, δωροδοκίες και ό,τι άλλο θέλετε στο @celpidis και στο Google+
This entry was posted in Featured, Misc, Science, Storage, Technology. Bookmark the permalink.